 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| circRHOT1 | |||
| Gene | RHOT1 | Organism | Human |
| Genome Locus | n/a | Build | hg19 |
| Disease | Pancreatic Cancer | ICD-10 | Malignant neoplasm of Pancreas, unspecified (C25.9) |
| DBLink | Link to database | PMID | 30444423 |
| Experimental Method | |||
| Sample Type | Cell Lines | Comparison | The human pancreatic cancer cell lines PATU8988, PATU8988/FU and the immortal human pancreatic duct epithelial cell line HPDE6c-7 were purchased |
| Method for Estimation | Quantitative PCR | PCR Details | |
| Primers (Experimented) | Forward AGACAAAGACAGCAGGTTCC ReverseCGGCATACACTATACAGATGAC | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
| Citation | |||
| Qu, S, Hao, X, Song, W, Niu, K, Yang, X, Zhang, X, Shang, R, Wang, Q, Li, H, Liu, Z (2019). Circular RNA circRHOT1 is upregulated and promotes cell proliferation and invasion in pancreatic cancer. Epigenomics, 11, 1:53-63. | |||